ID: 955195486_955195492

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 955195486 955195492
Species Human (GRCh38) Human (GRCh38)
Location 3:56801786-56801808 3:56801802-56801824
Sequence CCTTGGCCACCATGGCGGCTGCC GGCTGCCGGGCCTGCCCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 299} {0: 1, 1: 0, 2: 1, 3: 21, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!