ID: 955221332_955221336

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955221332 955221336
Species Human (GRCh38) Human (GRCh38)
Location 3:57025785-57025807 3:57025808-57025830
Sequence CCTGTCCTACTCACCAATGTATC CATGAGCCCAGCACAGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} {0: 1, 1: 2, 2: 31, 3: 328, 4: 2214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!