ID: 955287036_955287042

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 955287036 955287042
Species Human (GRCh38) Human (GRCh38)
Location 3:57651956-57651978 3:57651987-57652009
Sequence CCCAACACCTAGGTGGGAGGATC CAAGAGTTTAAGACTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 243} {0: 2, 1: 71, 2: 917, 3: 9089, 4: 53715}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!