ID: 955339264_955339276

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 955339264 955339276
Species Human (GRCh38) Human (GRCh38)
Location 3:58112343-58112365 3:58112364-58112386
Sequence CCCTGGCCCCCAGCCAGGCCCCT CTTTCTATGCAGTCGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 135, 4: 963} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!