ID: 955339761_955339768

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 955339761 955339768
Species Human (GRCh38) Human (GRCh38)
Location 3:58116348-58116370 3:58116374-58116396
Sequence CCCAGAAAGGTGGCTGCTTGGGC GGTGTGTCCTGGCCTGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 172} {0: 1, 1: 0, 2: 8, 3: 38, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!