ID: 955365566_955365570

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 955365566 955365570
Species Human (GRCh38) Human (GRCh38)
Location 3:58307061-58307083 3:58307078-58307100
Sequence CCCAGCATGGGGAAAAGCTAGAG CTAGAGCCGAGGCCCAGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 238} {0: 1, 1: 0, 2: 0, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!