ID: 955390894_955390899

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 955390894 955390899
Species Human (GRCh38) Human (GRCh38)
Location 3:58521508-58521530 3:58521525-58521547
Sequence CCCACTTGTCTCCAGGCCTTCTG CTTCTGCCATGCTCATGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 228} {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!