ID: 955445419_955445423

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 955445419 955445423
Species Human (GRCh38) Human (GRCh38)
Location 3:59004984-59005006 3:59005014-59005036
Sequence CCTTACTCTATCCATACCTTTTG ATTTTGTAATGCCTTCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 201} {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!