ID: 955445638_955445643

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 955445638 955445643
Species Human (GRCh38) Human (GRCh38)
Location 3:59007136-59007158 3:59007154-59007176
Sequence CCCCATTGGCCTGAGAACCACCC CACCCCCAACTCCCCAACAGTGG
Strand - +
Off-target summary {0: 11, 1: 23, 2: 49, 3: 45, 4: 166} {0: 1, 1: 1, 2: 3, 3: 35, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!