ID: 955447049_955447056

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 955447049 955447056
Species Human (GRCh38) Human (GRCh38)
Location 3:59023619-59023641 3:59023642-59023664
Sequence CCAGTGACCACCAACTTTGTGGG GCAACTGGATAAAGCAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!