ID: 955563701_955563703

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 955563701 955563703
Species Human (GRCh38) Human (GRCh38)
Location 3:60221935-60221957 3:60221969-60221991
Sequence CCTATATAAATGTGGGTATGCAC TTCGCATTCCATTAGGAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130} {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!