ID: 955612665_955612671

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 955612665 955612671
Species Human (GRCh38) Human (GRCh38)
Location 3:60774499-60774521 3:60774547-60774569
Sequence CCATGTTGACCAGGCTGGTCTCG CACCTTGACCTCCCAAAGAGTGG
Strand - +
Off-target summary {0: 2038, 1: 54917, 2: 176853, 3: 217441, 4: 133606} {0: 2, 1: 6, 2: 212, 3: 779, 4: 1702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!