|
Left Crispr |
Right Crispr |
Crispr ID |
955612665 |
955612671 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:60774499-60774521
|
3:60774547-60774569
|
Sequence |
CCATGTTGACCAGGCTGGTCTCG |
CACCTTGACCTCCCAAAGAGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2038, 1: 54917, 2: 176853, 3: 217441, 4: 133606} |
{0: 2, 1: 6, 2: 212, 3: 779, 4: 1702} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|