ID: 955701944_955701949

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 955701944 955701949
Species Human (GRCh38) Human (GRCh38)
Location 3:61690332-61690354 3:61690367-61690389
Sequence CCTTTCTGGGTGTTTGTTGCAGG CTGCTTTTCTCCAGGATAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167} {0: 1, 1: 0, 2: 1, 3: 29, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!