ID: 955798207_955798215

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 955798207 955798215
Species Human (GRCh38) Human (GRCh38)
Location 3:62659758-62659780 3:62659790-62659812
Sequence CCACCTGGGTGAAGAAGAGCTCA CAGTTAGCTATATAGCAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 162} {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!