ID: 955801969_955801979

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 955801969 955801979
Species Human (GRCh38) Human (GRCh38)
Location 3:62696048-62696070 3:62696093-62696115
Sequence CCAAGGGCCTTGACCCCTACATA CAGTAGTCAAAGAGGTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 93} {0: 1, 1: 0, 2: 0, 3: 6, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!