|
Left Crispr |
Right Crispr |
| Crispr ID |
955806607 |
955806612 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:62742477-62742499
|
3:62742507-62742529
|
| Sequence |
CCTACAAATATCTGATCTTCCAC |
ACAAAAAGAAGCAATGGCAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 202, 3: 1389, 4: 1994} |
{0: 1, 1: 2, 2: 79, 3: 271, 4: 935} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|