ID: 955821519_955821526

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 955821519 955821526
Species Human (GRCh38) Human (GRCh38)
Location 3:62901054-62901076 3:62901100-62901122
Sequence CCACCCACTATAGGACCTCAGGC TCCTTTCCTCCTAAGCGAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!