ID: 955870722_955870723

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 955870722 955870723
Species Human (GRCh38) Human (GRCh38)
Location 3:63435729-63435751 3:63435754-63435776
Sequence CCATCTATATTCTCACATATACA AATTTCATCAAAATATTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 448} {0: 1, 1: 0, 2: 5, 3: 74, 4: 870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!