ID: 955884813_955884821

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 955884813 955884821
Species Human (GRCh38) Human (GRCh38)
Location 3:63586492-63586514 3:63586534-63586556
Sequence CCTTCTTCCATCCCTATCCCCAG ATGAGTTTCTTGTATCCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 89, 4: 789} {0: 1, 1: 0, 2: 2, 3: 16, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!