|
Left Crispr |
Right Crispr |
Crispr ID |
955913851 |
955913853 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:63886117-63886139
|
3:63886147-63886169
|
Sequence |
CCTGGAGGATATTAAGTGAAATA |
CACAGAAAGACAAATACTGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 29, 2: 55, 3: 106, 4: 479} |
{0: 7, 1: 24, 2: 82, 3: 166, 4: 579} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|