ID: 955913851_955913853

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 955913851 955913853
Species Human (GRCh38) Human (GRCh38)
Location 3:63886117-63886139 3:63886147-63886169
Sequence CCTGGAGGATATTAAGTGAAATA CACAGAAAGACAAATACTGCAGG
Strand - +
Off-target summary {0: 2, 1: 29, 2: 55, 3: 106, 4: 479} {0: 7, 1: 24, 2: 82, 3: 166, 4: 579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!