ID: 955914844_955914848

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 955914844 955914848
Species Human (GRCh38) Human (GRCh38)
Location 3:63896550-63896572 3:63896593-63896615
Sequence CCTTCCTCAATCTGTTTCTTCAG TAACAGCTCTTTTGAACACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 468} {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!