ID: 955982349_955982354

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 955982349 955982354
Species Human (GRCh38) Human (GRCh38)
Location 3:64539744-64539766 3:64539766-64539788
Sequence CCTCTGTCCTCCTGTTGCCTAGG GCAGTATTATTGCCAAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 264} {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!