ID: 956105574_956105576

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 956105574 956105576
Species Human (GRCh38) Human (GRCh38)
Location 3:65814225-65814247 3:65814260-65814282
Sequence CCTTCTTTCATATTCATCTACAT ATAAAATTCATTCTCTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 407} {0: 1, 1: 0, 2: 1, 3: 27, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!