ID: 956147837_956147845

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 956147837 956147845
Species Human (GRCh38) Human (GRCh38)
Location 3:66210116-66210138 3:66210149-66210171
Sequence CCTCCCTCCTTCTCCCTTTTCTA TGAGCCTATATGATGTATCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 197, 4: 1807} {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!