ID: 956322038_956322050

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 956322038 956322050
Species Human (GRCh38) Human (GRCh38)
Location 3:68007971-68007993 3:68008015-68008037
Sequence CCAGGCTGCAGCGAGCGCGCAAG GGCCGCCCCGGGAGAAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86} {0: 1, 1: 0, 2: 0, 3: 38, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!