ID: 956444969_956444974

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 956444969 956444974
Species Human (GRCh38) Human (GRCh38)
Location 3:69317325-69317347 3:69317350-69317372
Sequence CCTCAGTCCAGGGAATCTGGAAT GGTCTGAGAGGATAAAAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 214} {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!