ID: 956453110_956453112

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 956453110 956453112
Species Human (GRCh38) Human (GRCh38)
Location 3:69393376-69393398 3:69393390-69393412
Sequence CCCATTTTTACTAGTTAATCAAC TTAATCAACTGAGCAGACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 203} {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!