ID: 956462330_956462347

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 956462330 956462347
Species Human (GRCh38) Human (GRCh38)
Location 3:69484983-69485005 3:69485033-69485055
Sequence CCCCCCACCTTCTGCCCAGGAGG CACCCAGGCTGCTGGCACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 515} {0: 3, 1: 14, 2: 15, 3: 74, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!