ID: 956468548_956468554

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 956468548 956468554
Species Human (GRCh38) Human (GRCh38)
Location 3:69542224-69542246 3:69542267-69542289
Sequence CCTGCGGCGCTCCGGGGCTGTAG GCTGCGCACCGCGCGGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79} {0: 1, 1: 0, 2: 1, 3: 8, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!