ID: 956468548_956468558

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 956468548 956468558
Species Human (GRCh38) Human (GRCh38)
Location 3:69542224-69542246 3:69542275-69542297
Sequence CCTGCGGCGCTCCGGGGCTGTAG CCGCGCGGGACCTGGGGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79} {0: 1, 1: 1, 2: 2, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!