ID: 956487567_956487575

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 956487567 956487575
Species Human (GRCh38) Human (GRCh38)
Location 3:69739302-69739324 3:69739330-69739352
Sequence CCCCGCCTGGCCTTCTGGGAGCT TTTCGTGGGAGCGGCTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 511} {0: 1, 1: 0, 2: 1, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!