ID: 956501985_956501993

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 956501985 956501993
Species Human (GRCh38) Human (GRCh38)
Location 3:69896862-69896884 3:69896907-69896929
Sequence CCTTCAAACATTGCAGTTCAGCC CTGTAGTGGTTTGTGTTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121} {0: 1, 1: 0, 2: 1, 3: 19, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!