ID: 956632585_956632590

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 956632585 956632590
Species Human (GRCh38) Human (GRCh38)
Location 3:71331213-71331235 3:71331229-71331251
Sequence CCCCGCACTTGGAGTGGCCAGCT GCCAGCTGGCCCGCAAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 32, 3: 145, 4: 533} {0: 1, 1: 0, 2: 6, 3: 41, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!