ID: 956654210_956654218

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 956654210 956654218
Species Human (GRCh38) Human (GRCh38)
Location 3:71533601-71533623 3:71533653-71533675
Sequence CCAACCCCATTATTGTTCTGTGA AATTCTGCAGAATTATTTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161} {0: 1, 1: 0, 2: 5, 3: 75, 4: 683}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!