ID: 956675173_956675184

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 956675173 956675184
Species Human (GRCh38) Human (GRCh38)
Location 3:71725687-71725709 3:71725727-71725749
Sequence CCCACGGGGGTGAGAGGGACCGG GGCTCTGCAGCCATGCAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102} {0: 1, 1: 0, 2: 2, 3: 25, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!