ID: 956675829_956675841

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 956675829 956675841
Species Human (GRCh38) Human (GRCh38)
Location 3:71731052-71731074 3:71731101-71731123
Sequence CCAGCCACTCCCAGTCCTCACTC GACTGCAACAGCCTCCTAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 509} {0: 2, 1: 9, 2: 70, 3: 219, 4: 829}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!