ID: 956697887_956697890

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 956697887 956697890
Species Human (GRCh38) Human (GRCh38)
Location 3:71934111-71934133 3:71934152-71934174
Sequence CCACTCAATTTGTGAGACTTTGT CTGAATATACAAATAGACCATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 22, 3: 95, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!