ID: 956809993_956809999

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 956809993 956809999
Species Human (GRCh38) Human (GRCh38)
Location 3:72855580-72855602 3:72855613-72855635
Sequence CCTTCCTCATAGATCACATGCAT CAGGATCTGGCTGGGTACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183} {0: 1, 1: 0, 2: 21, 3: 293, 4: 1930}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!