ID: 956953524_956953530

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 956953524 956953530
Species Human (GRCh38) Human (GRCh38)
Location 3:74310556-74310578 3:74310608-74310630
Sequence CCTGTCCACAGCTGCATAGGGTT GTAATTGTGCTAGTGGAACAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 12, 4: 87} {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!