ID: 957142900_957142904

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 957142900 957142904
Species Human (GRCh38) Human (GRCh38)
Location 3:76384570-76384592 3:76384608-76384630
Sequence CCAAGACTGGGTAATTTATAAAG GACTCACAGTTCCACAGGACTGG
Strand - +
Off-target summary {0: 3429, 1: 4465, 2: 3325, 3: 3035, 4: 2495} {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!