ID: 957157342_957157345

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 957157342 957157345
Species Human (GRCh38) Human (GRCh38)
Location 3:76561908-76561930 3:76561948-76561970
Sequence CCTTCTTCAAAATTCAGGACAAC AACTTCATATAGAAGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 267} {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!