ID: 957191822_957191826

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 957191822 957191826
Species Human (GRCh38) Human (GRCh38)
Location 3:77019617-77019639 3:77019634-77019656
Sequence CCATGAAAGGAAATGTCCCACTG CCACTGGTGAAACCAGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 242} {0: 1, 1: 0, 2: 2, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!