ID: 957216530_957216538

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 957216530 957216538
Species Human (GRCh38) Human (GRCh38)
Location 3:77327479-77327501 3:77327512-77327534
Sequence CCATTTTACAATTTAAGACCATG CCGGACCCATTATTGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 379} {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!