ID: 957548735_957548742

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 957548735 957548742
Species Human (GRCh38) Human (GRCh38)
Location 3:81676235-81676257 3:81676267-81676289
Sequence CCTAGCCCCCACAGTGTTCACAG ATAGTCTTGGAGCAACATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 336} {0: 1, 1: 1, 2: 0, 3: 7, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!