ID: 957866431_957866436

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 957866431 957866436
Species Human (GRCh38) Human (GRCh38)
Location 3:86029870-86029892 3:86029919-86029941
Sequence CCACAGTCAAGGATAAAATTGTC AGTTTGGTGTGGAGCCCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 299} {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!