ID: 957895724_957895726

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 957895724 957895726
Species Human (GRCh38) Human (GRCh38)
Location 3:86419209-86419231 3:86419226-86419248
Sequence CCTTTTAAACACCATCACTCAGC CTCAGCCCAAAAATTTGAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!