ID: 958428385_958428390

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 958428385 958428390
Species Human (GRCh38) Human (GRCh38)
Location 3:94007075-94007097 3:94007121-94007143
Sequence CCGCGCCTTATCTGAGCCTAAAC TTAGAAGTCATTTTAATGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 35, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!