ID: 958735636_958735650

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 958735636 958735650
Species Human (GRCh38) Human (GRCh38)
Location 3:98006725-98006747 3:98006769-98006791
Sequence CCTAAAATAACCCAGAATATTAA TGGAGGGTGAGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 540} {0: 1, 1: 1, 2: 28, 3: 361, 4: 2427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!