ID: 958805013_958805017

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 958805013 958805017
Species Human (GRCh38) Human (GRCh38)
Location 3:98799679-98799701 3:98799718-98799740
Sequence CCCGTAATTGGGAGTGGTTCAGC TCCTGCCCTGGTGAGTTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 0, 2: 2, 3: 9, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!