ID: 958896708_958896713

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 958896708 958896713
Species Human (GRCh38) Human (GRCh38)
Location 3:99837668-99837690 3:99837707-99837729
Sequence CCAACACTTCTCCTTCTGACCTG TTATTTCTAAAAAATGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 313} {0: 1, 1: 1, 2: 12, 3: 179, 4: 1527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!